Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircMTO1 | |||
Gene | MTO1 | Organism | Human |
Genome Locus | Build | hg19 | |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | PMID | 30556859 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | 63 pairs of CRC tissues and adjacent non-tumor tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GAGCTGTAGAAGATCTTATTC ReverseCACAGGCCATCCAAGGCATC | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
Ge, Z, Li, LF, Wang, CY, Wang, Y, Ma, WL (2018). CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/펲-catenin signaling pathway in colorectal cancer. Eur Rev Med Pharmacol Sci, 22, 23:8203-8209. |